FASTQ (Illumina PHRED+64) to IMGT (EMBL variant) converter

Convert a FASTQ (Illumina PHRED+64) sequence file to IMGT (EMBL variant).

Convert from Convert to

What kind of sequence is in your file?

This output needs a sequence type. The selected input format does not record it, so the converter will use your choice.

Choose your sequence file

Maximum file size: 50 MB. The file is checked before conversion.

FASTQ (Illumina PHRED+64) → IMGT (EMBL variant)

The output keeps sequence letters but removes per-base quality scores.
The output writes every sequence letter in the same case, so lowercase (soft-masked) regions are no longer marked.

About this conversion

The converter reads records in the input format and writes them in the output format. Data that the output format cannot store may be lost. The notes under the Convert file button list the important limits for this pair.

Run it with Biopython

For batch work, you can use Biopython's SeqIO.convert function. This output needs a sequence type, so replace the example molecule type with DNA, RNA, or protein to match your file.

from Bio import SeqIO

count = SeqIO.convert("input.fastq-illumina", "fastq-illumina",
                      "output.imgt", "imgt",
                      molecule_type="DNA")
print("Converted %i records" % count)

Sample input file: FASTQ (Illumina PHRED+64)

Copy this example into a file, or download it, to try a FASTQ (Illumina PHRED+64) conversion.

@read1 example read 1
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
hhhhhhhhhgggggggggffffffffeeeeeeeeeddddddddcccccccccbbbbbbbb
@read2 example read 2
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTC
+
hhhhhhhgggggggfffffffeeeeeeedddddddcccccccbbbbbb
@read3 example read 3
TTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTC
+
hhhhhhhhgggggggfffffffeeeeeeedddddddcccccccbbbbbbb

Download sample (sample.fastq, 394 bytes)

Samples are small illustrative files. Some come from the Biopython test suite (see the project's sample notes); they are not real study data.

Choose another conversion