FASTQ (Sanger PHRED+33) to QUAL quality scores converter

Convert a FASTQ (Sanger PHRED+33) sequence file to QUAL quality scores.

Convert from Convert to Choose your sequence file

Maximum file size: 50 MB. The file is checked before conversion.

FASTQ (Sanger PHRED+33) → QUAL quality scores

QUAL files store quality scores only. Sequence letters are not written.

About this conversion

The converter reads records in the input format and writes them in the output format. Data that the output format cannot store may be lost. The notes under the Convert file button list the important limits for this pair.

Run it with Biopython

For batch work, you can use Biopython's SeqIO.convert function. This pair needs no molecule type argument.

from Bio import SeqIO

count = SeqIO.convert("input.fastq", "fastq",
                      "output.qual", "qual")
print("Converted %i records" % count)

Sample input file: FASTQ (Sanger PHRED+33)

Copy this example into a file, or download it, to try a FASTQ (Sanger PHRED+33) conversion.

@read1 example read 1
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
IIIIIIIIIHHHHHHHHHGGGGGGGGFFFFFFFFFEEEEEEEEDDDDDDDDDCCCCCCCC
@read2 example read 2
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTC
+
IIIIIIIHHHHHHHGGGGGGGFFFFFFFEEEEEEEDDDDDDDCCCCCC
@read3 example read 3
TTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTC
+
IIIIIIIIHHHHHHHGGGGGGGFFFFFFFEEEEEEEDDDDDDDCCCCCCC

Download sample (sample.fastq, 394 bytes)

Samples are small illustrative files. Some come from the Biopython test suite (see the project's sample notes); they are not real study data.

Choose another conversion