Mauve XMFA alignment to MAF alignment converter

Convert a Mauve XMFA alignment sequence file to MAF alignment.

Convert from Convert to Choose your sequence file

Maximum file size: 50 MB. The file is checked before conversion.

Mauve XMFA alignment → MAF alignment

Only the aligned sequence rows are converted; alignment annotations such as scores and consensus lines are not kept. A file with several alignments can be converted only to sequence formats such as FASTA.
The selected output is an alignment format. Every sequence must be the same length and already aligned. This does not create an alignment.

About this conversion

The converter reads records in the input format and writes them in the output format. Data that the output format cannot store may be lost. The notes under the Convert file button list the important limits for this pair.

The converter writes one alignment per MAF alignment file, so upload one alignment at a time. A file with several alignments (for example several MAF blocks or Stockholm sections) is refused rather than merged into one.

Run it with Biopython

For batch work, you can use Biopython's SeqIO.convert function. This pair needs no molecule type argument.

from Bio import SeqIO

count = SeqIO.convert("input.mauve", "mauve",
                      "output.maf", "maf")
print("Converted %i records" % count)

Sample input file: Mauve XMFA alignment

Copy this example into a file, or download it, to try a Mauve XMFA alignment conversion.

#FormatVersion Mauve1
#Sequence1Entry	1
#Sequence2Entry	2
#Sequence3Entry	3
> 1:0-0 + seq1.fa # seq1
ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG
> 2:0-0 + seq2.fa # seq2
ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGA---
> 3:0-0 + seq3.fa # seq3
ATGTTCGCGATTGTAATGGGCCGCTGAAAGGGTGCCCGA
=

Download sample (sample.xmfa, 273 bytes)

Samples are small illustrative files. Some come from the Biopython test suite (see the project's sample notes); they are not real study data.

Choose another conversion