PHYLIP alignment (sequential) to SeqXML converter

Convert a PHYLIP alignment (sequential) sequence file to SeqXML.

Convert from Convert to

What kind of sequence is in your file?

This output needs a sequence type. The selected input format does not record it, so the converter will use your choice.

Choose your sequence file

Maximum file size: 50 MB. The file is checked before conversion.

PHYLIP alignment (sequential) → SeqXML

About this conversion

The converter reads records in the input format and writes them in the output format. Data that the output format cannot store may be lost. The notes under the Convert file button list the important limits for this pair.

Run it with Biopython

For batch work, you can use Biopython's SeqIO.convert function. This output needs a sequence type, so replace the example molecule type with DNA, RNA, or protein to match your file.

from Bio import SeqIO

count = SeqIO.convert("input.phylip-sequential", "phylip-sequential",
                      "output.seqxml", "seqxml",
                      molecule_type="DNA")
print("Converted %i records" % count)

Sample input file: PHYLIP alignment (sequential)

Copy this example into a file, or download it, to try a PHYLIP alignment (sequential) conversion.

 3 39
seq1      ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG
seq2      ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGA---
seq3      ATGTTCGCGATTGTAATGGGCCGCTGAAAGGGTGCCCGA

Download sample (sample.phy, 156 bytes)

Samples are small illustrative files. Some come from the Biopython test suite (see the project's sample notes); they are not real study data.

Choose another conversion