Stockholm alignment to DNA Strider / Serial Cloner (xdna) converter

Convert a Stockholm alignment sequence file to DNA Strider / Serial Cloner (xdna).

Convert from Convert to Choose your sequence file

Maximum file size: 50 MB. The file is checked before conversion.

Stockholm alignment → DNA Strider / Serial Cloner (xdna)

This output format holds exactly one sequence. Upload a file with a single record.
Only the aligned sequence rows are converted; alignment annotations such as scores and consensus lines are not kept. A file with several alignments can be converted only to sequence formats such as FASTA.

About this conversion

The converter reads records in the input format and writes them in the output format. Data that the output format cannot store may be lost. The notes under the Convert file button list the important limits for this pair.

Run it with Biopython

For batch work, you can use Biopython's SeqIO.convert function. This pair needs no molecule type argument.

from Bio import SeqIO

count = SeqIO.convert("input.stockholm", "stockholm",
                      "output.xdna", "xdna")
print("Converted %i records" % count)

Sample input file: Stockholm alignment

Copy this example into a file, or download it, to try a Stockholm alignment conversion.

# STOCKHOLM 1.0
#=GF SQ 3
seq1 ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG
#=GS seq1 AC seq1
#=GS seq1 DE aligned row 1
seq2 ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGA---
#=GS seq2 AC seq2
#=GS seq2 DE aligned row 2
seq3 ATGTTCGCGATTGTAATGGGCCGCTGAAAGGGTGCCCGA
#=GS seq3 AC seq3
#=GS seq3 DE aligned row 3
//

Download sample (sample.sto, 299 bytes)

Samples are small illustrative files. Some come from the Biopython test suite (see the project's sample notes); they are not real study data.

Choose another conversion